{
 "cells": [
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "# Working with the Unix Shell 2"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {
    "collapsed": true
   },
   "source": [
    "**Exercise 1.1**. Download a compressed data archive from https://www.dropbox.com/s/vivut71p4bkurhw/data.tar.gz (10 points)\n",
    "\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "collapsed": true
   },
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "**Exercise 1.2**. Regenerate the original data folder from `data.tar.gz`. Change directory into the data folder. List the files in the folder. (10 points)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "collapsed": true
   },
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "**Exercise 1.3**. Check if any files have been corrupted using the MDFSUM checksum file and note its `FILENAME`.  Delete any corrupted files. (10 points)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "collapsed": true
   },
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "**Exercise 1.4**. Replace the corrupted file with a correct copy from https://www.dropbox.com/s/vf8qcoj07mcq7wn/FILENAME. You will need to replace `FILENAME` with the correct filename as noted earlier. Check that there are no more `md5sum` errors. Go back to the original directory. (10 points)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "collapsed": true
   },
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "**Exercise 2.1**. (20 points) Write a script `extract.sh` that extracts only the raw sequence letters and quality scores from a [FASTQ](GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCGTTCAGGGATACGACGTTTGTATTTTAAGAATCTGA) file. For example, if `test.fq` consists of\n",
    "\n",
    "```\n",
    "@071112_SLXA-EAS1_s_7:5:1:817:345\n",
    "GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC\n",
    "+071112_SLXA-EAS1_s_7:5:1:817:345\n",
    "IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC\n",
    "@071112_SLXA-EAS1_s_7:5:1:801:338\n",
    "GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGA\n",
    "+071112_SLXA-EAS1_s_7:5:1:801:338\n",
    "IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBI\n",
    "```\n",
    "\n",
    "then\n",
    "\n",
    "```bash\n",
    "cat test.fq | extract.sh \n",
    "```\n",
    "\n",
    "should print \n",
    "\n",
    "```\n",
    "GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC\n",
    "IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC\n",
    "GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGA\n",
    "IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBI\n",
    "```\n",
    "\n",
    "For all of Exercise 2, create test.fq, and run your script on test.fq to check that it gets the expected results."
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "collapsed": true
   },
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "markdown",
   "metadata": {
    "collapsed": true
   },
   "source": [
    "**Exercise 2.2** (20 points) Write a script `extract_seq.sh` that extracts only the raw sequence letters from a FASTQ file and combines them into a single string. For example,\n",
    "\n",
    "```\n",
    "cat test.fq | bash extract_seq.sh\n",
    "```\n",
    "\n",
    "should print\n",
    "\n",
    "```\n",
    "GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCGTTCAGGGATACGACGTTTGTATTTTAAGAATCTGA\n",
    "```"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "collapsed": true
   },
   "outputs": [],
   "source": []
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "**Exercise 2.3** Write a script `calc_gc.sh` that estimates the GC ratio (the fraction of all bases that are either G or C) from a FASTQ file. For example, the GC ratio of test.fq is .5138, (20 points)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {
    "collapsed": true
   },
   "outputs": [],
   "source": []
  }
 ],
 "metadata": {
  "kernelspec": {
   "display_name": "Bash",
   "language": "bash",
   "name": "bash"
  },
  "language_info": {
   "codemirror_mode": "shell",
   "file_extension": ".sh",
   "mimetype": "text/x-sh",
   "name": "bash"
  }
 },
 "nbformat": 4,
 "nbformat_minor": 2
}