{ "cells": [ { "cell_type": "markdown", "metadata": {}, "source": [ "Run this once in a code cell\n", "\n", "```bash\n", "pip install version_information\n", "```" ] }, { "cell_type": "code", "execution_count": 1, "metadata": { "collapsed": true }, "outputs": [], "source": [ "import numpy as npa\n", "import pandas as pd\n", "import matplotlib\n", "import matplotlib.pyplot as plt\n", "import seaborn as sns\n", "%matplotlib inline\n", "\n", "%load_ext version_information\n", "%load_ext rpy2.ipython" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "# Getting Started with Python" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "## Live Demo of Jupyter Features\n", "\n", "* Administration interface\n", " * Files\n", " * Running\n", " * Uploading notebooks\n", " * New notebook\n", "* Notebook interface\n", " * Menu\n", " * Cells\n", " * Keyboard shortcuts\n", " * Getting help\n", "* Notebook magics\n", " * `bash`\n", " * `R`\n", " * Other" ] }, { "cell_type": "code", "execution_count": null, "metadata": { "collapsed": true }, "outputs": [], "source": [] }, { "cell_type": "markdown", "metadata": {}, "source": [ "## Using Markdown in Jupyter for Literate Programming\n", "\n", "[Markdown Syntax](https://help.github.com/articles/basic-writing-and-formatting-syntax)" ] }, { "cell_type": "code", "execution_count": null, "metadata": { "collapsed": true }, "outputs": [], "source": [] }, { "cell_type": "markdown", "metadata": {}, "source": [ "## Elements of Python" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "### Code and comments" ] }, { "cell_type": "code", "execution_count": 46, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "[3, 6, 9]" ] }, "execution_count": 46, "metadata": {}, "output_type": "execute_result" } ], "source": [ "# The code below makes a list of numbers\n", "list(range(3, 10, 3))" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "### Types" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### None" ] }, { "cell_type": "code", "execution_count": 92, "metadata": { "collapsed": true }, "outputs": [], "source": [ "None" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### Logical" ] }, { "cell_type": "code", "execution_count": 26, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "(True, False)" ] }, "execution_count": 26, "metadata": {}, "output_type": "execute_result" } ], "source": [ "True, False" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### Numeric" ] }, { "cell_type": "code", "execution_count": 28, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "(1, 2, 3, 3.14, 2.78)" ] }, "execution_count": 28, "metadata": {}, "output_type": "execute_result" } ], "source": [ "1, 2, 3, 3.14, 2.78" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### Strings" ] }, { "cell_type": "code", "execution_count": 32, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "('a', 'hello', 'spaces are OK', 'double quotes are OK too')" ] }, "execution_count": 32, "metadata": {}, "output_type": "execute_result" } ], "source": [ "'a', 'hello', 'spaces are OK', \"double quotes are OK too\"" ] }, { "cell_type": "code", "execution_count": 30, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "'triple quoted strings\\ncan span\\nmultiple lines'" ] }, "execution_count": 30, "metadata": {}, "output_type": "execute_result" } ], "source": [ "'''triple quoted strings\n", "can span\n", "multiple lines'''" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### Tab and newline characters" ] }, { "cell_type": "code", "execution_count": 36, "metadata": { "collapsed": false }, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "a b\tc\n", "d\te f\n" ] } ], "source": [ "print('a b\\tc\\nd\\te f')" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### String interpolation" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "Old style" ] }, { "cell_type": "code", "execution_count": 40, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "'There are 8 planets in our solar system'" ] }, "execution_count": 40, "metadata": {}, "output_type": "execute_result" } ], "source": [ "'There are %d planets in our %s system' % (8, 'solar')" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "New style" ] }, { "cell_type": "code", "execution_count": 41, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "'There are 3.14 planets in our lunar system'" ] }, "execution_count": 41, "metadata": {}, "output_type": "execute_result" } ], "source": [ "'There are {} planets in our {} system'.format(3.14, 'lunar')" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "### Operators" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### Arithmetic" ] }, { "cell_type": "code", "execution_count": 3, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "(-1, 5, 1, 3.5, 3, 16, True, False, True, True)" ] }, "execution_count": 3, "metadata": {}, "output_type": "execute_result" } ], "source": [ "-1, 2+3, 7%3, 7/2, 7//2, 2**4" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### Logical" ] }, { "cell_type": "code", "execution_count": 39, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "(True, False, True, True, False, True, False)" ] }, "execution_count": 39, "metadata": {}, "output_type": "execute_result" } ], "source": [ "True and True, True & False, True | False, 3 <= 4, 3 == 4, 3 != 4, 3 > 4" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "### Variables and Assignment" ] }, { "cell_type": "code", "execution_count": 4, "metadata": { "collapsed": false }, "outputs": [], "source": [ "a = 3\n", "b = 4\n", "c = a + b" ] }, { "cell_type": "code", "execution_count": 5, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "(3, 4, 7)" ] }, "execution_count": 5, "metadata": {}, "output_type": "execute_result" } ], "source": [ "a, b, c" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "### Containers (Collections)" ] }, { "cell_type": "code", "execution_count": 6, "metadata": { "collapsed": false }, "outputs": [], "source": [ "a_tuple = (1, 2, 3, 4)\n", "a_list = ['a', 'b', 'c', 'd']\n", "a_set = {1, 2, 2, 3, 3, 3}\n", "a_dict = {'c': 1, 'b': 2, 'a': 3}" ] }, { "cell_type": "code", "execution_count": 7, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "(1, 2, 3, 4)" ] }, "execution_count": 7, "metadata": {}, "output_type": "execute_result" } ], "source": [ "a_tuple" ] }, { "cell_type": "code", "execution_count": 8, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "['a', 'b', 'c', 'd']" ] }, "execution_count": 8, "metadata": {}, "output_type": "execute_result" } ], "source": [ "a_list" ] }, { "cell_type": "code", "execution_count": 9, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "{1, 2, 3}" ] }, "execution_count": 9, "metadata": {}, "output_type": "execute_result" } ], "source": [ "a_set" ] }, { "cell_type": "code", "execution_count": 10, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "{'a': 3, 'b': 2, 'c': 1}" ] }, "execution_count": 10, "metadata": {}, "output_type": "execute_result" } ], "source": [ "a_dict" ] }, { "cell_type": "code", "execution_count": 11, "metadata": { "collapsed": true }, "outputs": [], "source": [ "from collections import OrderedDict" ] }, { "cell_type": "code", "execution_count": 12, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "OrderedDict([('c', 1), ('b', 2), ('a', 3)])" ] }, "execution_count": 12, "metadata": {}, "output_type": "execute_result" } ], "source": [ "a_ordereddict = OrderedDict([('c', 1), ('b', 2), ('a', 3)])\n", "a_ordereddict" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "## Indexing a container" ] }, { "cell_type": "code", "execution_count": 13, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "1" ] }, "execution_count": 13, "metadata": {}, "output_type": "execute_result" } ], "source": [ "a_tuple[0]" ] }, { "cell_type": "code", "execution_count": 14, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "['b', 'c', 'd']" ] }, "execution_count": 14, "metadata": {}, "output_type": "execute_result" } ], "source": [ "a_list[1:4]" ] }, { "cell_type": "code", "execution_count": 15, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "2" ] }, "execution_count": 15, "metadata": {}, "output_type": "execute_result" } ], "source": [ "a_dict['b']" ] }, { "cell_type": "code", "execution_count": 16, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "1" ] }, "execution_count": 16, "metadata": {}, "output_type": "execute_result" } ], "source": [ "a_ordereddict['c']" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "## Conversion between types" ] }, { "cell_type": "code", "execution_count": 85, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "(123, int)" ] }, "execution_count": 85, "metadata": {}, "output_type": "execute_result" } ], "source": [ "x = 123\n", "x, type(x)" ] }, { "cell_type": "code", "execution_count": 86, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "('123', str)" ] }, "execution_count": 86, "metadata": {}, "output_type": "execute_result" } ], "source": [ "x = str(x)\n", "x, type(x)" ] }, { "cell_type": "code", "execution_count": 87, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "(123.0, float)" ] }, "execution_count": 87, "metadata": {}, "output_type": "execute_result" } ], "source": [ "x = float(x)\n", "x, type(x)" ] }, { "cell_type": "code", "execution_count": 89, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "dict" ] }, "execution_count": 89, "metadata": {}, "output_type": "execute_result" } ], "source": [ "d = {'a': 1, 'b': 2}\n", "type(d)" ] }, { "cell_type": "code", "execution_count": 90, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "['a', 'b']" ] }, "execution_count": 90, "metadata": {}, "output_type": "execute_result" } ], "source": [ "list(d)" ] }, { "cell_type": "code", "execution_count": 91, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "[('a', 1), ('b', 2)]" ] }, "execution_count": 91, "metadata": {}, "output_type": "execute_result" } ], "source": [ "list(d.items())" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "## Generator objects\n", "\n", "A generator is like a container that will only ever give you one thing at a time. They are very useful because they use up very little memory, allowing us to handle massive objects easily." ] }, { "cell_type": "code", "execution_count": 112, "metadata": { "collapsed": true }, "outputs": [], "source": [ "gen = (i**2 for i in range(10**40))" ] }, { "cell_type": "code", "execution_count": 113, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ " at 0x11af5b360>" ] }, "execution_count": 113, "metadata": {}, "output_type": "execute_result" } ], "source": [ "gen" ] }, { "cell_type": "code", "execution_count": 114, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "0" ] }, "execution_count": 114, "metadata": {}, "output_type": "execute_result" } ], "source": [ "next(gen)" ] }, { "cell_type": "code", "execution_count": 115, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "1" ] }, "execution_count": 115, "metadata": {}, "output_type": "execute_result" } ], "source": [ "next(gen)" ] }, { "cell_type": "code", "execution_count": 116, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "4" ] }, "execution_count": 116, "metadata": {}, "output_type": "execute_result" } ], "source": [ "next(gen)" ] }, { "cell_type": "code", "execution_count": 121, "metadata": { "collapsed": false }, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "9\n", "16\n", "25\n" ] } ], "source": [ "for i in range(3):\n", " print(next(gen))" ] }, { "cell_type": "code", "execution_count": 124, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "range(1, 15)" ] }, "execution_count": 124, "metadata": {}, "output_type": "execute_result" } ], "source": [ "r = range(1,15)\n", "r" ] }, { "cell_type": "code", "execution_count": 125, "metadata": { "collapsed": false }, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "5\n", "10\n" ] } ], "source": [ "# Looping through a generator also works\n", "for item in r:\n", " if item % 5 == 0:\n", " print(item)" ] }, { "cell_type": "code", "execution_count": 126, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "[1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14]" ] }, "execution_count": 126, "metadata": {}, "output_type": "execute_result" } ], "source": [ "# Be very careful of converting to list unless you know the size\n", "list(r)" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "## Controlling program flow" ] }, { "cell_type": "code", "execution_count": 17, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "'a'" ] }, "execution_count": 17, "metadata": {}, "output_type": "execute_result" } ], "source": [ "'a' if 3 < 4 else 'b'" ] }, { "cell_type": "code", "execution_count": 18, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "'b'" ] }, "execution_count": 18, "metadata": {}, "output_type": "execute_result" } ], "source": [ "'a' if 4 < 3 else 'b'" ] }, { "cell_type": "code", "execution_count": 19, "metadata": { "collapsed": false }, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "A\n" ] } ], "source": [ "score = np.random.uniform(60, 100)\n", "\n", "if score > 90:\n", " print('A')\n", "elif score > 80:\n", " print('B')\n", "else:\n", " print('C')" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "### Looping" ] }, { "cell_type": "code", "execution_count": 20, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "[10, 12, 14, 16, 18]" ] }, "execution_count": 20, "metadata": {}, "output_type": "execute_result" } ], "source": [ "list(range(10, 20, 2))" ] }, { "cell_type": "code", "execution_count": 21, "metadata": { "collapsed": false }, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "10 100\n", "12 144\n", "14 196\n", "16 256\n", "18 324\n" ] } ], "source": [ "for i in range(10, 20, 2):\n", " print(i, i**2)" ] }, { "cell_type": "code", "execution_count": 22, "metadata": { "collapsed": false }, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "0\n", "1\n", "2\n", "3\n", "4\n" ] } ], "source": [ "max_count = 5\n", "count = 0\n", "while (count < max_count):\n", " print(count)\n", " count += 1" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "### 3 Ways to Populate a List" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### List Comprehension" ] }, { "cell_type": "code", "execution_count": 23, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "[0, 1, 4, 9, 16]" ] }, "execution_count": 23, "metadata": {}, "output_type": "execute_result" } ], "source": [ "[x**2 for x in range(5)]" ] }, { "cell_type": "code", "execution_count": 24, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "[0, 4, 16]" ] }, "execution_count": 24, "metadata": {}, "output_type": "execute_result" } ], "source": [ "[x**2 for x in range(5) if x % 2 == 0]" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### Looping" ] }, { "cell_type": "code", "execution_count": 1, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "[0, 1, 4, 9, 16]" ] }, "execution_count": 1, "metadata": {}, "output_type": "execute_result" } ], "source": [ "xs = []\n", "for x in range(5):\n", " xs.append(x**2)\n", "xs" ] }, { "cell_type": "code", "execution_count": 3, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "[0, 4, 16]" ] }, "execution_count": 3, "metadata": {}, "output_type": "execute_result" } ], "source": [ "xs = []\n", "for x in range(5):\n", " if x % 2 == 0:\n", " xs.append(x**2)\n", "xs" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### Map and filter" ] }, { "cell_type": "code", "execution_count": 6, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "[0, 1, 4, 9, 16]" ] }, "execution_count": 6, "metadata": {}, "output_type": "execute_result" } ], "source": [ "list(map(lambda x: x**2, range(5)))" ] }, { "cell_type": "code", "execution_count": 7, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "[0, 4, 16]" ] }, "execution_count": 7, "metadata": {}, "output_type": "execute_result" } ], "source": [ "list(map(lambda x: x**2, filter(lambda x: x % 2 == 0, range(5))))" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "### User-defined functions" ] }, { "cell_type": "code", "execution_count": 44, "metadata": { "collapsed": true }, "outputs": [], "source": [ "def f(x):\n", " \"\"\"Say something about the function here.\"\"\"\n", " return x" ] }, { "cell_type": "code", "execution_count": 26, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "3.14" ] }, "execution_count": 26, "metadata": {}, "output_type": "execute_result" } ], "source": [ "f(3.14)" ] }, { "cell_type": "code", "execution_count": 27, "metadata": { "collapsed": true }, "outputs": [], "source": [ "def g(a, b):\n", " \"\"\"Calculate the sum of a and b.\"\"\"\n", " return a + b" ] }, { "cell_type": "code", "execution_count": 28, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "7" ] }, "execution_count": 28, "metadata": {}, "output_type": "execute_result" } ], "source": [ "g(3, 4)" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### Default arguments" ] }, { "cell_type": "code", "execution_count": 29, "metadata": { "collapsed": true }, "outputs": [], "source": [ "def h(a= 0 , b = 1, c = 2):\n", " \"\"\"Cacluates some complicated mathematical function.\"\"\"\n", " return a + 2*b + 3*c" ] }, { "cell_type": "code", "execution_count": 30, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "8" ] }, "execution_count": 30, "metadata": {}, "output_type": "execute_result" } ], "source": [ "h()" ] }, { "cell_type": "code", "execution_count": 31, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "9" ] }, "execution_count": 31, "metadata": {}, "output_type": "execute_result" } ], "source": [ "h(1)" ] }, { "cell_type": "code", "execution_count": 32, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "11" ] }, "execution_count": 32, "metadata": {}, "output_type": "execute_result" } ], "source": [ "h(1, 2)" ] }, { "cell_type": "code", "execution_count": 33, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "14" ] }, "execution_count": 33, "metadata": {}, "output_type": "execute_result" } ], "source": [ "h(1, 2, 3)" ] }, { "cell_type": "code", "execution_count": 34, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "10" ] }, "execution_count": 34, "metadata": {}, "output_type": "execute_result" } ], "source": [ "h(c = 1, b = 2, a = 3)" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "## Using Libraries" ] }, { "cell_type": "code", "execution_count": 35, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "3.141592653589793" ] }, "execution_count": 35, "metadata": {}, "output_type": "execute_result" } ], "source": [ "import math\n", "\n", "math.pi" ] }, { "cell_type": "code", "execution_count": 36, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "array([ 0. , 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1. ])" ] }, "execution_count": 36, "metadata": {}, "output_type": "execute_result" } ], "source": [ "import numpy as np\n", "\n", "np.linspace(0, 1, 11)" ] }, { "cell_type": "code", "execution_count": 37, "metadata": { "collapsed": true }, "outputs": [], "source": [ "from numpy.random import rand" ] }, { "cell_type": "code", "execution_count": 38, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "array([ 0.12365436, 0.57294035, 0.08970509, 0.70075327])" ] }, "execution_count": 38, "metadata": {}, "output_type": "execute_result" } ], "source": [ "rand(4)" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "### Built-in functions\n", "\n", "Many functions are automatically imported into the main namespace. That is why we can use functions such as `range` or `list` without importing them first." ] }, { "cell_type": "code", "execution_count": 97, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "'ArithmeticError, AssertionError, AttributeError, BaseException, BlockingIOError, BrokenPipeError, BufferError, BytesWarning, ChildProcessError, ConnectionAbortedError, ConnectionError, ConnectionRefusedError, ConnectionResetError, DeprecationWarning, EOFError, Ellipsis, EnvironmentError, Exception, False, FileExistsError, FileNotFoundError, FloatingPointError, FutureWarning, GeneratorExit, IOError, ImportError, ImportWarning, IndentationError, IndexError, InterruptedError, IsADirectoryError, KeyError, KeyboardInterrupt, LookupError, MemoryError, NameError, None, NotADirectoryError, NotImplemented, NotImplementedError, OSError, OverflowError, PendingDeprecationWarning, PermissionError, ProcessLookupError, RecursionError, ReferenceError, ResourceWarning, RuntimeError, RuntimeWarning, StopAsyncIteration, StopIteration, SyntaxError, SyntaxWarning, SystemError, SystemExit, TabError, TimeoutError, True, TypeError, UnboundLocalError, UnicodeDecodeError, UnicodeEncodeError, UnicodeError, UnicodeTranslateError, UnicodeWarning, UserWarning, ValueError, Warning, ZeroDivisionError, __IPYTHON__, __build_class__, __debug__, __doc__, __import__, __loader__, __name__, __package__, __spec__, abs, all, any, ascii, bin, bool, bytearray, bytes, callable, chr, classmethod, compile, complex, copyright, credits, delattr, dict, dir, divmod, dreload, enumerate, eval, exec, filter, float, format, frozenset, get_ipython, getattr, globals, hasattr, hash, help, hex, id, input, int, isinstance, issubclass, iter, len, license, list, locals, map, max, memoryview, min, next, object, oct, open, ord, pow, print, property, range, repr, reversed, round, set, setattr, slice, sorted, staticmethod, str, sum, super, tuple, type, vars, zip'" ] }, "execution_count": 97, "metadata": {}, "output_type": "execute_result" } ], "source": [ "', '.join(dir(__builtin__))" ] }, { "cell_type": "code", "execution_count": 98, "metadata": { "collapsed": false }, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "Help on class zip in module builtins:\n", "\n", "class zip(object)\n", " | zip(iter1 [,iter2 [...]]) --> zip object\n", " | \n", " | Return a zip object whose .__next__() method returns a tuple where\n", " | the i-th element comes from the i-th iterable argument. The .__next__()\n", " | method continues until the shortest iterable in the argument sequence\n", " | is exhausted and then it raises StopIteration.\n", " | \n", " | Methods defined here:\n", " | \n", " | __getattribute__(self, name, /)\n", " | Return getattr(self, name).\n", " | \n", " | __iter__(self, /)\n", " | Implement iter(self).\n", " | \n", " | __new__(*args, **kwargs) from builtins.type\n", " | Create and return a new object. See help(type) for accurate signature.\n", " | \n", " | __next__(self, /)\n", " | Implement next(self).\n", " | \n", " | __reduce__(...)\n", " | Return state information for pickling.\n", "\n" ] } ], "source": [ "help(zip)" ] }, { "cell_type": "code", "execution_count": 103, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "[('a', 0), ('b', 1), ('c', 2)]" ] }, "execution_count": 103, "metadata": {}, "output_type": "execute_result" } ], "source": [ "list(zip(['a', 'b', 'c'], range(10)))" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "## Working with vectors and arrays" ] }, { "cell_type": "code", "execution_count": 39, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "array([[ 0.72558757, 0.62773131, 0.84824601, 0.23886442],\n", " [ 0.52841628, 0.71965435, 0.32039652, 0.29125637],\n", " [ 0.81117304, 0.96326656, 0.63946624, 0.51574475]])" ] }, "execution_count": 39, "metadata": {}, "output_type": "execute_result" } ], "source": [ "A = np.random.random((3,4))\n", "A" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "### Indexing a matrix" ] }, { "cell_type": "code", "execution_count": 40, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "0.7255875679496957" ] }, "execution_count": 40, "metadata": {}, "output_type": "execute_result" } ], "source": [ "A[0,0]" ] }, { "cell_type": "code", "execution_count": 41, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "0.5157447477346595" ] }, "execution_count": 41, "metadata": {}, "output_type": "execute_result" } ], "source": [ "A[2,3]" ] }, { "cell_type": "code", "execution_count": 42, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "array([ 0.52841628, 0.71965435, 0.32039652, 0.29125637])" ] }, "execution_count": 42, "metadata": {}, "output_type": "execute_result" } ], "source": [ "A[1]" ] }, { "cell_type": "code", "execution_count": 43, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "array([ 0.52841628, 0.71965435, 0.32039652, 0.29125637])" ] }, "execution_count": 43, "metadata": {}, "output_type": "execute_result" } ], "source": [ "A[1, :]" ] }, { "cell_type": "code", "execution_count": 44, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "array([ 0.84824601, 0.32039652, 0.63946624])" ] }, "execution_count": 44, "metadata": {}, "output_type": "execute_result" } ], "source": [ "A[:, 2]" ] }, { "cell_type": "code", "execution_count": 45, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "array([[ 0.62773131, 0.84824601, 0.23886442],\n", " [ 0.71965435, 0.32039652, 0.29125637]])" ] }, "execution_count": 45, "metadata": {}, "output_type": "execute_result" } ], "source": [ "A[:2, 1:]" ] }, { "cell_type": "code", "execution_count": 46, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "array([[ 0.71965435, 0.32039652],\n", " [ 0.96326656, 0.63946624]])" ] }, "execution_count": 46, "metadata": {}, "output_type": "execute_result" } ], "source": [ "A[1:3, 1:3]" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "### Vectorized functions" ] }, { "cell_type": "code", "execution_count": 47, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "array([[ 7.25587568, 6.27731313, 8.48246012, 2.38864421],\n", " [ 5.28416285, 7.19654349, 3.20396517, 2.9125637 ],\n", " [ 8.11173037, 9.63266563, 6.39466244, 5.15744748]])" ] }, "execution_count": 47, "metadata": {}, "output_type": "execute_result" } ], "source": [ "A * 10" ] }, { "cell_type": "code", "execution_count": 48, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "7.2298034265026363" ] }, "execution_count": 48, "metadata": {}, "output_type": "execute_result" } ], "source": [ "A.sum()" ] }, { "cell_type": "code", "execution_count": 49, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "array([ 2.06517689, 2.31065222, 1.80810877, 1.04586554])" ] }, "execution_count": 49, "metadata": {}, "output_type": "execute_result" } ], "source": [ "A.sum(axis = 0)" ] }, { "cell_type": "code", "execution_count": 50, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "array([ 2.44042931, 1.85972352, 2.92965059])" ] }, "execution_count": 50, "metadata": {}, "output_type": "execute_result" } ], "source": [ "A.sum(axis = 1)" ] }, { "cell_type": "code", "execution_count": 51, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "array([ 0.81117304, 0.96326656, 0.84824601, 0.51574475])" ] }, "execution_count": 51, "metadata": {}, "output_type": "execute_result" } ], "source": [ "A.max(axis = 0)" ] }, { "cell_type": "code", "execution_count": 52, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "array([[ 1.46370278, 1.61712698, 1.30349727, 0.7455799 ],\n", " [ 1.61712698, 1.83983145, 1.37902178, 0.85634626],\n", " [ 1.30349727, 1.37902178, 1.2310923 , 0.62573468],\n", " [ 0.7455799 , 0.85634626, 0.62573468, 0.40787913]])" ] }, "execution_count": 52, "metadata": {}, "output_type": "execute_result" } ], "source": [ "A.T @ A" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "## Input and output\n", "\n", "We will mostly be using the `pandas` library to read in tabular data files, so this section is just for completeness." ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### This uses a Jupyter magic to create a file" ] }, { "cell_type": "code", "execution_count": 59, "metadata": { "collapsed": false }, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "Writing test1.csv\n" ] } ], "source": [ "%%file test1.csv\n", "1,2,3\n", "4,5,6" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### Opening a file in `read` mode\n", "\n", "The `open` function returns a `generator`, allowing us to loop through each line of potentially massive files without using much memory." ] }, { "cell_type": "code", "execution_count": 66, "metadata": { "collapsed": false }, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "1,2,3\n", "4,5,6" ] } ], "source": [ "with open('test1.csv', 'r') as f:\n", " for line in f:\n", " print(line, end='')" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### Opening a file in `write` mode" ] }, { "cell_type": "code", "execution_count": 80, "metadata": { "collapsed": false }, "outputs": [], "source": [ "s = ['to be', 'or not to be']\n", "with open('test2.txt', 'w') as f:\n", " f.write('\\n'.join(s))" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### Opening a file in `append` mode" ] }, { "cell_type": "code", "execution_count": null, "metadata": { "collapsed": true }, "outputs": [], "source": [ "with open('text2.txt', 'a') as f:\n", " f.write('that is the question')" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### Check file contents with a Unix shell command" ] }, { "cell_type": "code", "execution_count": 76, "metadata": { "collapsed": false }, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "to be\r\n", "or not to be\r\n", "that is the question" ] } ], "source": [ "! cat 'test2.txt'" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### Reading *entire* content of file into a single string\n", "\n", "Warning: This may use a large amount of memory. The line by line approach shown above is recommended." ] }, { "cell_type": "code", "execution_count": 77, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "'to be\\nor not to be\\nthat is the question'" ] }, "execution_count": 77, "metadata": {}, "output_type": "execute_result" } ], "source": [ "with open('test2.txt', 'r') as f:\n", " s = f.read()\n", "s" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "#### Reading *entire* content of file into list of strings\n", "\n", "Warning: This may use a large amount of memory. The line by line approach shown above is recommended." ] }, { "cell_type": "code", "execution_count": 78, "metadata": { "collapsed": false }, "outputs": [ { "data": { "text/plain": [ "['to be\\n', 'or not to be\\n', 'that is the question']" ] }, "execution_count": 78, "metadata": {}, "output_type": "execute_result" } ], "source": [ "with open('test2.txt', 'r') as f:\n", " s = f.readlines()\n", "s" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "## Getting comfortable with error messages" ] }, { "cell_type": "code", "execution_count": 49, "metadata": { "collapsed": false }, "outputs": [ { "ename": "NameError", "evalue": "name 'foo' is not defined", "output_type": "error", "traceback": [ "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m", "\u001b[0;31mNameError\u001b[0m Traceback (most recent call last)", "\u001b[0;32m\u001b[0m in \u001b[0;36m\u001b[0;34m()\u001b[0m\n\u001b[0;32m----> 1\u001b[0;31m \u001b[0mfoo\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m", "\u001b[0;31mNameError\u001b[0m: name 'foo' is not defined" ] } ], "source": [ "foo" ] }, { "cell_type": "code", "execution_count": 47, "metadata": { "collapsed": false }, "outputs": [ { "ename": "NameError", "evalue": "name 'Sort' is not defined", "output_type": "error", "traceback": [ "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m", "\u001b[0;31mNameError\u001b[0m Traceback (most recent call last)", "\u001b[0;32m\u001b[0m in \u001b[0;36m\u001b[0;34m()\u001b[0m\n\u001b[0;32m----> 1\u001b[0;31m \u001b[0mSort\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0;34m[\u001b[0m\u001b[0;36m2\u001b[0m\u001b[0;34m,\u001b[0m\u001b[0;36m3\u001b[0m\u001b[0;34m,\u001b[0m\u001b[0;36m1\u001b[0m\u001b[0;34m]\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m", "\u001b[0;31mNameError\u001b[0m: name 'Sort' is not defined" ] } ], "source": [ "Sort([2,3,1])" ] }, { "cell_type": "code", "execution_count": 1, "metadata": { "collapsed": false }, "outputs": [ { "ename": "IndentationError", "evalue": "expected an indented block (, line 2)", "output_type": "error", "traceback": [ "\u001b[0;36m File \u001b[0;32m\"\"\u001b[0;36m, line \u001b[0;32m2\u001b[0m\n\u001b[0;31m print(i)\u001b[0m\n\u001b[0m ^\u001b[0m\n\u001b[0;31mIndentationError\u001b[0m\u001b[0;31m:\u001b[0m expected an indented block\n" ] } ], "source": [ "for i in range(3):\n", "print(i)" ] }, { "cell_type": "code", "execution_count": 48, "metadata": { "collapsed": false }, "outputs": [ { "ename": "TypeError", "evalue": "unsupported operand type(s) for +: 'int' and 'str'", "output_type": "error", "traceback": [ "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m", "\u001b[0;31mTypeError\u001b[0m Traceback (most recent call last)", "\u001b[0;32m\u001b[0m in \u001b[0;36m\u001b[0;34m()\u001b[0m\n\u001b[0;32m----> 1\u001b[0;31m \u001b[0;36m3\u001b[0m \u001b[0;34m+\u001b[0m \u001b[0;34m'1'\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m", "\u001b[0;31mTypeError\u001b[0m: unsupported operand type(s) for +: 'int' and 'str'" ] } ], "source": [ "3 + '1'" ] }, { "cell_type": "code", "execution_count": 50, "metadata": { "collapsed": false }, "outputs": [ { "ename": "IndexError", "evalue": "list index out of range", "output_type": "error", "traceback": [ "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m", "\u001b[0;31mIndexError\u001b[0m Traceback (most recent call last)", "\u001b[0;32m\u001b[0m in \u001b[0;36m\u001b[0;34m()\u001b[0m\n\u001b[1;32m 1\u001b[0m \u001b[0mnumbers\u001b[0m \u001b[0;34m=\u001b[0m \u001b[0;34m[\u001b[0m\u001b[0;36m1\u001b[0m\u001b[0;34m,\u001b[0m\u001b[0;36m2\u001b[0m\u001b[0;34m,\u001b[0m\u001b[0;36m3\u001b[0m\u001b[0;34m]\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0;32m----> 2\u001b[0;31m \u001b[0mnumbers\u001b[0m\u001b[0;34m[\u001b[0m\u001b[0;36m3\u001b[0m\u001b[0;34m]\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m", "\u001b[0;31mIndexError\u001b[0m: list index out of range" ] } ], "source": [ "numbers = [1,2,3]\n", "numbers[3]" ] }, { "cell_type": "code", "execution_count": 52, "metadata": { "collapsed": false }, "outputs": [ { "ename": "KeyError", "evalue": "'homer'", "output_type": "error", "traceback": [ "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m", "\u001b[0;31mKeyError\u001b[0m Traceback (most recent call last)", "\u001b[0;32m\u001b[0m in \u001b[0;36m\u001b[0;34m()\u001b[0m\n\u001b[1;32m 1\u001b[0m \u001b[0mcontacts\u001b[0m \u001b[0;34m=\u001b[0m \u001b[0;34m{\u001b[0m\u001b[0;34m'bart'\u001b[0m\u001b[0;34m:\u001b[0m \u001b[0;34m'ann@fox.cartoons.org'\u001b[0m\u001b[0;34m,\u001b[0m \u001b[0;34m'bob'\u001b[0m\u001b[0;34m:\u001b[0m \u001b[0;34m'bob@pinapple.under.thesea'\u001b[0m\u001b[0;34m}\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0;32m----> 2\u001b[0;31m \u001b[0mcontacts\u001b[0m\u001b[0;34m[\u001b[0m\u001b[0;34m'homer'\u001b[0m\u001b[0;34m]\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m", "\u001b[0;31mKeyError\u001b[0m: 'homer'" ] } ], "source": [ "contacts = {'bart': 'ann@fox.cartoons.org', 'bob': 'bob@pinapple.under.thesea'}\n", "contacts['homer']" ] }, { "cell_type": "code", "execution_count": 53, "metadata": { "collapsed": false }, "outputs": [ { "ename": "ZeroDivisionError", "evalue": "integer division or modulo by zero", "output_type": "error", "traceback": [ "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m", "\u001b[0;31mZeroDivisionError\u001b[0m Traceback (most recent call last)", "\u001b[0;32m\u001b[0m in \u001b[0;36m\u001b[0;34m()\u001b[0m\n\u001b[1;32m 1\u001b[0m \u001b[0mx\u001b[0m \u001b[0;34m=\u001b[0m \u001b[0;36m1\u001b[0m \u001b[0;34m//\u001b[0m \u001b[0;36m3\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0;32m----> 2\u001b[0;31m \u001b[0my\u001b[0m \u001b[0;34m=\u001b[0m \u001b[0;36m3\u001b[0m \u001b[0;34m//\u001b[0m \u001b[0mx\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m", "\u001b[0;31mZeroDivisionError\u001b[0m: integer division or modulo by zero" ] } ], "source": [ "x = 1 // 3\n", "y = 3 // x" ] }, { "cell_type": "code", "execution_count": 54, "metadata": { "collapsed": false }, "outputs": [ { "ename": "TypeError", "evalue": "range expected at most 3 arguments, got 4", "output_type": "error", "traceback": [ "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m", "\u001b[0;31mTypeError\u001b[0m Traceback (most recent call last)", "\u001b[0;32m\u001b[0m in \u001b[0;36m\u001b[0;34m()\u001b[0m\n\u001b[0;32m----> 1\u001b[0;31m \u001b[0mrange\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0;36m1\u001b[0m\u001b[0;34m,\u001b[0m\u001b[0;36m2\u001b[0m\u001b[0;34m,\u001b[0m\u001b[0;36m3\u001b[0m\u001b[0;34m,\u001b[0m\u001b[0;36m4\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m", "\u001b[0;31mTypeError\u001b[0m: range expected at most 3 arguments, got 4" ] } ], "source": [ "range(1,2,3,4)" ] }, { "cell_type": "code", "execution_count": 55, "metadata": { "collapsed": false }, "outputs": [ { "ename": "FileNotFoundError", "evalue": "[Errno 2] No such file or directory: 'spongebob.txt'", "output_type": "error", "traceback": [ "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m", "\u001b[0;31mFileNotFoundError\u001b[0m Traceback (most recent call last)", "\u001b[0;32m\u001b[0m in \u001b[0;36m\u001b[0;34m()\u001b[0m\n\u001b[0;32m----> 1\u001b[0;31m \u001b[0mopen\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0;34m'spongebob.txt'\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m", "\u001b[0;31mFileNotFoundError\u001b[0m: [Errno 2] No such file or directory: 'spongebob.txt'" ] } ], "source": [ "open('spongebob.txt')" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "## Exercises" ] }, { "cell_type": "markdown", "metadata": { "collapsed": true }, "source": [ "**1a**. Create a list of the integers from 1 to 9. The solution is \n", "\n", "```python\n", "[1, 2, 3, 4, 5, 6, 7, 8, 9]\n", "```\n", "\n", "**1b**. Create a list of the cubes of the **odd** integers from 1 to 9. The solution is \n", "\n", "```python\n", "[1, 3, 5, 7, 9]\n", "```\n", "\n", "**1c**. Create a list of the cubes of the **odd** integers from 1 to 9. The solution is \n", "\n", "```python\n", "[1, 27, 125, 343, 729]\n", "```" ] }, { "cell_type": "code", "execution_count": null, "metadata": { "collapsed": false }, "outputs": [], "source": [ "\n", "\n", "\n" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "**2** Strings have many useful methods. Herw we will learn how to read the standard Python documentation for [strings](https://docs.python.org/3/library/stdtypes.html#string-methods) to understand what some of these string methods do. We will work with the following DNA sequence (gi|568815592:31575567-31578336 Homo sapiens chromosome 6, GRCh38.p7 Primary Assembly)\n", "\n", "```\n", "CAGACGCTCCCTCAGCAAGGACAGCAGAGGACCAGCTAAGAGGGAGAGAAGCAACTACAGACCCCCCCTG\n", "AAAACAACCCTCAGACGCCACATCCCCTGACAAGCTGCCAGGCAGGTTCTCTTCCTCTCACATACTGACC\n", "CACGGCTCCACCCTCTCTCCCCTGGAAAGGACACCATGAGCACTGAAAGCATGATCCGGGACGTGGAGCT\n", "GGCCGAGGAGGCGCTCCCCAAGAAGACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCTCAGCCTC\n", "TTCTCCTTCCTGATCGTGGCAGGCGCCACCACGCTCTTCTGCCTGCTGCACTTTGGAGTGATCGGCCCCC\n", "AGAGGGAAGAGGTGAGTGCCTGGCCAGCCTTCATCCACTCTCCCACCCAAGGGGAAATGGAGACGCAAGA\n", "GAGGGAGAGAGATGGGATGGGTGAAAGATGTGCGCTGATAGGGAGGGATGGAGAGAAAAAAACGTGGAGA\n", "AAGACGGGGATGCAGAAAGAGATGTGGCAAGAGATGGGGAAGAGAGAGAGAGAAAGATGGAGAGACAGGA\n", "TGTCTGGCACATGGAAGGTGCTCACTAAGTGTGTATGGAGTGAATGAATGAATGAATGAATGAACAAGCA\n", "GATATATAAATAAGATATGGAGACAGATGTGGGGTGTGAGAAGAGAGATGGGGGAAGAAACAAGTGATAT\n", "GAATAAAGATGGTGAGACAGAAAGAGCGGGAAATATGACAGCTAAGGAGAGAGATGGGGGAGATAAGGAG\n", "AGAAGAAGATAGGGTGTCTGGCACACAGAAGACACTCAGGGAAAGAGCTGTTGAATGCCTGGAAGGTGAA\n", "TACACAGATGAATGGAGAGAGAAAACCAGACACCTCAGGGCTAAGAGCGCAGGCCAGACAGGCAGCCAGC\n", "TGTTCCTCCTTTAAGGGTGACTCCCTCGATGTTAACCATTCTCCTTCTCCCCAACAGTTCCCCAGGGACC\n", "TCTCTCTAATCAGCCCTCTGGCCCAGGCAGTCAGTAAGTGTCTCCAAACCTCTTTCCTAATTCTGGGTTT\n", "GGGTTTGGGGGTAGGGTTAGTACCGGTATGGAAGCAGTGGGGGAAATTTAAAGTTTTGGTCTTGGGGGAG\n", "GATGGATGGAGGTGAAAGTAGGGGGGTATTTTCTAGGAAGTTTAAGGGTCTCAGCTTTTTCTTTTCTCTC\n", "TCCTCTTCAGGATCATCTTCTCGAACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGGTAAGAGCTCTG\n", "AGGATGTGTCTTGGAACTTGGAGGGCTAGGATTTGGGGATTGAAGCCCGGCTGATGGTAGGCAGAACTTG\n", "GAGACAATGTGAGAAGGACTCGCTGAGCTCAAGGGAAGGGTGGAGGAACAGCACAGGCCTTAGTGGGATA\n", "CTCAGAACGTCATGGCCAGGTGGGATGTGGGATGACAGACAGAGAGGACAGGAACCGGATGTGGGGTGGG\n", "CAGAGCTCGAGGGCCAGGATGTGGAGAGTGAACCGACATGGCCACACTGACTCTCCTCTCCCTCTCTCCC\n", "TCCCTCCAGCAAACCCTCAAGCTGAGGGGCAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGGC\n", "CAATGGCGTGGAGCTGAGAGATAACCAGCTGGTGGTGCCATCAGAGGGCCTGTACCTCATCTACTCCCAG\n", "GTCCTCTTCAAGGGCCAAGGCTGCCCCTCCACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCCG\n", "TCTCCTACCAGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGAGACCCCAGAGGG\n", "GGCTGAGGCCAAGCCCTGGTATGAGCCCATCTATCTGGGAGGGGTCTTCCAGCTGGAGAAGGGTGACCGA\n", "CTCAGCGCTGAGATCAATCGGCCCGACTATCTCGACTTTGCCGAGTCTGGGCAGGTCTACTTTGGGATCA\n", "TTGCCCTGTGAGGAGGACGAACATCCAACCTTCCCAAACGCCTCCCCTGCCCCAATCCCTTTATTACCCC\n", "CTCCTTCAGACACCCTCAACCTCTTCTGGCTCAAAAAGAGAATTGGGGGCTTAGGGTCGGAACCCAAGCT\n", "TAGAACTTTAAGCAACAAGACCACCACTTCGAAACCTGGGATTCAGGAATGTGTGGCCTGCACAGTGAAG\n", "TGCTGGCAACCACTAAGAATTCAAACTGGGGCCTCCAGAACTCACTGGGGCCTACAGCTTTGATCCCTGA\n", "CATCTGGAATCTGGAGACCAGGGAGCCTTTGGTTCTGGCCAGAATGCTGCAGGACTTGAGAAGACCTCAC\n", "CTAGAAATTGACACAAGTGGACCTTAGGCCTTCCTCTCTCCAGATGTTTCCAGACTTCCTTGAGACACGG\n", "AGCCCAGCCCTCCCCATGGAGCCAGCTCCCTCTATTTATGTTTGCACTTGTGATTATTTATTATTTATTT\n", "ATTATTTATTTATTTACAGATGAATGTATTTATTTGGGAGACCGGGGTATCCTGGGGGACCCAATGTAGG\n", "AGCTGCCTTGGCTCAGACATGTTTTCCGTGAAAACGGAGCTGAACAATAGGCTGTTCCCATGTAGCCCCC\n", "TGGCCTCTGTGCCTTCTTTTGATTATGTTTTTTAAAATATTTATCTGATTAAGTTGTCTAAACAATGCTG\n", "ATTTGGTGACCAACTGTCACTCATTGCTGAGCCTCTGCTCCCCAGGGGAGTTGTGTCTGTAATCGCCCTA\n", "CTATTCAGTGGCGAGAAATAAAGTTTGCTTAGAAAAGAAA\n", "```\n", "\n", "**2a**. Assign the sequence to a string variable called `tnf`. (Hint: This string spans multiple lines)\n", "\n", "**2b**. Calculate the GC content \n", "\n", "![GC content](https://wikimedia.org/api/rest_v1/media/math/render/svg/e410e5ddc49b232b2c5f3b43e0cad51edb2e621b)\n", "\n", "**2c**. Find the RNA transcript using the mapping A to U, T to A, G to C, C to G." ] }, { "cell_type": "code", "execution_count": null, "metadata": { "collapsed": true }, "outputs": [], "source": [ "\n", "\n", "\n" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "**3**. You have 5 kids in your household, whose behavior has been\n", "\n", "- Ann, Good\n", "- Bob, Bad\n", "- Charlie, Good\n", "- David, Good\n", "- Ella, Bad\n", "\n", "On Christmas Eve, Santa will give good kids an iPhone 7 and bad kids a lump of coal.\n", "\n", "**3a**. Store the kids name and behavior in a dictionary called `santa_dict`.\n", "\n", "**3b**. On Christmas Eve Eve, David threw a tantrum and kicked his sister Ann. Change the dictionary entry for David to Bad.\n", "\n", "**3c**. Write a loop that prints the name of each child, followed by 'Coal' or 'iPhone'. The output should be\n", "\n", "```python\n", "David Coal\n", "Ann iPhone\n", "Ella Coal\n", "Charlie iPhone\n", "Bob Coal\n", "```" ] }, { "cell_type": "code", "execution_count": null, "metadata": { "collapsed": true }, "outputs": [], "source": [ "\n", "\n", "\n" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "**4a**. Write a function (call the function `collatz`) of a positive integer that returns the following result \n", "\n", "- If the number is even, divide it by two\n", "- If the number is odd, triple it and add one\n", "\n", "![Collatz](https://wikimedia.org/api/rest_v1/media/math/render/svg/f69ea6c9163eefcadeb36c93a68626610f1f4e75)\n", "\n", "**4b**. Write a loop that repeatedly calls `n = collatz(n)` given some start value `n` while `n` is not equal to 1. At each iteration in the loop, print the current value of `n`.\n", "\n", "**4c**. Write a function `collatz_sequence` that takes a positive integer argument `n` and returns the list of numbers generated by the while loop from **4b** starting with the given value of `n`. For example, `collatz_sequence(6)` should give the following output:\n", "\n", "```python\n", "[6, 3, 10, 5, 16, 8, 4, 2, 1]\n", "```" ] }, { "cell_type": "code", "execution_count": 17, "metadata": { "collapsed": false }, "outputs": [], "source": [ "\n", "\n", "\n" ] }, { "cell_type": "markdown", "metadata": {}, "source": [ "## Version information" ] }, { "cell_type": "code", "execution_count": 53, "metadata": { "collapsed": false }, "outputs": [ { "name": "stdout", "output_type": "stream", "text": [ "The version_information extension is already loaded. To reload it, use:\n", " %reload_ext version_information\n" ] }, { "data": { "application/json": { "Software versions": [ { "module": "Python", "version": "3.5.2 64bit [GCC 4.2.1 Compatible Apple LLVM 4.2 (clang-425.0.28)]" }, { "module": "IPython", "version": "5.0.0" }, { "module": "OS", "version": "Darwin 15.6.0 x86_64 i386 64bit" } ] }, "text/html": [ "
SoftwareVersion
Python3.5.2 64bit [GCC 4.2.1 Compatible Apple LLVM 4.2 (clang-425.0.28)]
IPython5.0.0
OSDarwin 15.6.0 x86_64 i386 64bit
Tue Aug 16 09:04:41 2016 EDT
" ], "text/latex": [ "\\begin{tabular}{|l|l|}\\hline\n", "{\\bf Software} & {\\bf Version} \\\\ \\hline\\hline\n", "Python & 3.5.2 64bit [GCC 4.2.1 Compatible Apple LLVM 4.2 (clang-425.0.28)] \\\\ \\hline\n", "IPython & 5.0.0 \\\\ \\hline\n", "OS & Darwin 15.6.0 x86\\_64 i386 64bit \\\\ \\hline\n", "\\hline \\multicolumn{2}{|l|}{Tue Aug 16 09:04:41 2016 EDT} \\\\ \\hline\n", "\\end{tabular}\n" ], "text/plain": [ "Software versions\n", "Python 3.5.2 64bit [GCC 4.2.1 Compatible Apple LLVM 4.2 (clang-425.0.28)]\n", "IPython 5.0.0\n", "OS Darwin 15.6.0 x86_64 i386 64bit\n", "Tue Aug 16 09:04:41 2016 EDT" ] }, "execution_count": 53, "metadata": {}, "output_type": "execute_result" } ], "source": [ "%load_ext version_information\n", "%version_information" ] }, { "cell_type": "code", "execution_count": null, "metadata": { "collapsed": true }, "outputs": [], "source": [] } ], "metadata": { "kernelspec": { "display_name": "Python 3", "language": "python", "name": "python3" }, "language_info": { "codemirror_mode": { "name": "ipython", "version": 3 }, "file_extension": ".py", "mimetype": "text/x-python", "name": "python", "nbconvert_exporter": "python", "pygments_lexer": "ipython3", "version": "3.5.2" } }, "nbformat": 4, "nbformat_minor": 0 }